Abstract: 【Objective】 To conduct prokaryotic fusion expression and bioactivity analysis on the insecticidal protein genes（Cry1A.301 and Vip3A）of Bacillus thuringiensis（Bt），so as to provide scientific reference for the exploration of insect-resistant gene resources and the creation of maize varieties. 【Method】 Utilized the connecting peptides to construct the fusion genes of Cry1A.301 and Vip3A with different insecticidal mechanisms. Then，constructed their prokaryotic expression vectors and induced expression in Escherichia coli. Prediction analysis on the physicochemical properties and domains of the fusion proteins as well as quantitative detection was conducted. Moreover，the insecticidal activities of the fusion proteins against Ostrinia furnacalis，Helicoverpa armigera and Spodoptera frugiperda were detected by the artificial diet mixed feeding method. 【Result】 The basic framework of the constructed fusion gene was 5'-Cry1A. 301-Vip3A-3'，with the nucleotide sequence（TCCACCTGCTCCACCTGCTCCACC）encoding the connecting peptide（8 amino acids） assembled in the middle. Through induced expression，the fusion protein Cry1A.301-Vip3A was formed. This fusion protein contained 1409 amino acids，with a molecular weight of approximately 157 kD. It was a stable acidic protein and encompassed 4 characteristic domains of the Cry1A.301 and Vip3A protein families. The fusion protein Cry1A.301-Vip3A could be successfully expressed in E. coli strain BL21（DE3），and there was no significant difference in the expression levels of Cry1A.301 and Vip3A proteins（P>0.05，the same below）. After feeding the fusion protein Cry1A.301-Vip3A for 7 d，the corrected mortality rates of O. furnacalis，H. armigera and S. frugiperda reached 100.00%. The insecticidal effect of the fusion protein Cry1A.301-Vip3A on O. furnacalis was not significantly different from that of the Cry1A.301 protein，but both were significantly higher than that of the Vip3A protein（P<0.05，the same below）. The insecticidal activity of the fusion protein Cry1A.301-Vip3A on H. armigera was not significantly different from those of Vip3A protein and Cry1A.301 protein. The insecticidal activity of the fusion protein Cry1A.301-Vip3A on S. frugiperda was not significantly different from that of Vip3A protein，but was significantly higher than that of Cry1A.301 protein. 【Conclusion】 The Cry1A.301-Vip3A fusion protein expressed in prokaryotes has a stable structure and exhibits good insecticidal activities against O. furnacalis，H. armigera and S. frugiperda.